Magicsheet logo

Repeated DNA Sequences

Medium
78.9%
Updated 6/1/2025

Repeated DNA Sequences

What is this problem about?

The Repeated DNA Sequences interview question gives you a DNA string composed only of 'A', 'C', 'G', and 'T'. You must find all 10-character-long substrings (subsequences of length 10) that appear more than once in the string. Return all such repeated substrings. This is a sliding window problem that can be optimized with rolling hashes or bit manipulation for efficiency.

Why is this asked in interviews?

This problem is asked at Apple, Tesla, Microsoft, Meta, Amazon, LinkedIn, and Google because it tests sliding window pattern recognition, hash table usage, and optionally, rolling hash or bit manipulation for optimization. It also has real-world relevance in bioinformatics — DNA sequence analysis and genome alignment use exactly these substring-matching techniques.

Algorithmic pattern used

The primary pattern is sliding window with a hash set. Use a set seen and a set repeated. Slide a window of size 10 across the string. For each window, check if the 10-character substring is in seen. If yes, add it to repeated. Otherwise, add it to seen. Return all elements in repeated. For optimization, use a rolling hash or bit packing (2 bits per character × 10 = 20 bits) to represent each window as an integer, enabling O(1) hashing per window.

Example explanation

String: "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"

Sliding windows of length 10:

  • "AAAAACCCCC" appears at position 0 and position 10 → repeated.
  • "AAAACCCCCA" → appears once.
  • "CCCCCAAAAA" → appears once.

Result: ["AAAAACCCCC", "CCCCCAAAAA"] (actual results depend on the string).

With bit packing: encode A=0, C=1, G=2, T=3. Each 10-char window = 20-bit integer. Rolling update: shift left by 2, add new character's 2 bits, mask to 20 bits.

Common mistakes candidates make

  • Using substring slicing inside the loop without a rolling hash, leading to O(n * L) time where L=10 — acceptable here since L is fixed, but not generalizable.
  • Not using two separate sets (seen vs repeated), causing the same repeated substring to appear multiple times in the result.
  • Forgetting to handle strings shorter than 10 characters.
  • Implementing the rolling hash with incorrect bit shifts or mask values.

Interview preparation tip

For the Repeated DNA Sequences coding problem, the sliding window and rolling hash interview pattern is the optimal approach. Start with the simple set-based O(n*10) solution, then optimize with bit packing for O(n) time. Interviewers at Grammarly and LinkedIn appreciate when you proactively offer the bit manipulation optimization as a follow-up, even if the simple version is accepted first. Practice the rolling hash update formula: hash = ((hash << 2) | new_char_bits) & mask.

Similar Questions